Transcript: Human NM_152549.2

Homo sapiens coiled-coil domain containing 112 (CCDC112), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
CCDC112 (153733)
Length:
2552
CDS:
514..1854

Additional Resources:

NCBI RefSeq record:
NM_152549.2
NBCI Gene record:
CCDC112 (153733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149829 CCAGCGCCAGTTTAAGTTAAA pLKO.1 1437 CDS 100% 13.200 18.480 N CCDC112 n/a
2 TRCN0000149974 CATATCCCACATAGGGCTATT pLKO.1 1798 CDS 100% 10.800 8.640 N CCDC112 n/a
3 TRCN0000147632 GAGTGACTAACCACATTCTTT pLKO.1 1915 3UTR 100% 5.625 4.500 N CCDC112 n/a
4 TRCN0000149910 GATCCCTCTAGGCTTTACAAA pLKO.1 1714 CDS 100% 5.625 3.938 N CCDC112 n/a
5 TRCN0000149210 GAGAGAGTGACTAACCACATT pLKO.1 1911 3UTR 100% 4.950 3.465 N CCDC112 n/a
6 TRCN0000147558 GCTTTGGGTAATTCAGAAACA pLKO.1 868 CDS 100% 4.950 3.465 N CCDC112 n/a
7 TRCN0000148098 GTGACTTCAGAATTGAGCATA pLKO.1 554 CDS 100% 4.950 3.465 N CCDC112 n/a
8 TRCN0000148439 CAGCAGAAGAAAGAACAGGAA pLKO.1 1480 CDS 100% 2.640 1.848 N CCDC112 n/a
9 TRCN0000148440 CCTGTAGACAAAGTAACACCA pLKO.1 922 CDS 100% 2.640 1.848 N CCDC112 n/a
10 TRCN0000146898 CTCAGAGAAATGATGGAAGAA pLKO.1 727 CDS 100% 4.950 2.970 N CCDC112 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09699 pDONR223 100% 99.8% 99.5% None 1023G>T;1061A>G n/a
2 ccsbBroad304_09699 pLX_304 0% 99.8% 99.5% V5 1023G>T;1061A>G n/a
3 TRCN0000470661 CTCAATTCCATACTTAGCTGCAAC pLX_317 36.2% 99.8% 99.5% V5 1023G>T;1061A>G n/a
Download CSV