Transcript: Human NM_152617.4

Homo sapiens ring finger protein 168 (RNF168), mRNA.

Source:
NCBI, updated 2019-08-16
Taxon:
Homo sapiens (human)
Gene:
RNF168 (165918)
Length:
5347
CDS:
596..2311

Additional Resources:

NCBI RefSeq record:
NM_152617.4
NBCI Gene record:
RNF168 (165918)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152617.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034136 CGTGGAACTGTGGACGATAAT pLKO.1 814 CDS 100% 13.200 18.480 N RNF168 n/a
2 TRCN0000369787 TTAAGTCACGAGCGACCTAAA pLKO_005 1577 CDS 100% 10.800 15.120 N RNF168 n/a
3 TRCN0000034138 CCGAAGAAATTCTCTCGTCAA pLKO.1 793 CDS 100% 4.050 5.670 N RNF168 n/a
4 TRCN0000034134 CGACACTTTCTCCACAGATAT pLKO.1 1419 CDS 100% 13.200 10.560 N RNF168 n/a
5 TRCN0000376450 GTGGAACTGTGGACGATAATT pLKO_005 815 CDS 100% 15.000 10.500 N RNF168 n/a
6 TRCN0000364830 AGAAGAACAGGACAGGTTATT pLKO_005 1921 CDS 100% 13.200 9.240 N RNF168 n/a
7 TRCN0000034135 CCTCCAGACAAAGTGCTAAAT pLKO.1 2039 CDS 100% 13.200 9.240 N RNF168 n/a
8 TRCN0000369714 ACTCCCTACAGCCTAGCATTT pLKO_005 2247 CDS 100% 10.800 7.560 N RNF168 n/a
9 TRCN0000369715 AGAAGTATTTGACACCGAAAT pLKO_005 1272 CDS 100% 10.800 7.560 N RNF168 n/a
10 TRCN0000364895 TCGTGCCTACTGATCAGTAAG pLKO_005 1724 CDS 100% 10.800 7.560 N RNF168 n/a
11 TRCN0000034137 GCAGTCAGTTAATAGAAGAAA pLKO.1 2179 CDS 100% 5.625 3.938 N RNF168 n/a
12 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 2935 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152617.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09762 pDONR223 100% 99.9% 99.8% None 14A>T n/a
2 ccsbBroad304_09762 pLX_304 0% 99.9% 99.8% V5 14A>T n/a
3 TRCN0000477136 TCAACCCAGCTGCACTGACCAATT pLX_317 21.8% 99.9% 99.8% V5 14A>T n/a
Download CSV