Transcript: Human NM_152624.6

Homo sapiens decapping mRNA 2 (DCP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DCP2 (167227)
Length:
10110
CDS:
137..1399

Additional Resources:

NCBI RefSeq record:
NM_152624.6
NBCI Gene record:
DCP2 (167227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152624.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296072 ACGATCTCTGCAGCCGATTTA pLKO_005 177 CDS 100% 13.200 18.480 N DCP2 n/a
2 TRCN0000310121 AGCATTACAGGTGATCTATTT pLKO_005 1851 3UTR 100% 13.200 10.560 N DCP2 n/a
3 TRCN0000050144 CCGTGGCATGTAATGGACATT pLKO.1 1299 CDS 100% 4.950 3.960 N DCP2 n/a
4 TRCN0000050143 CCACGGAAACTTCAGGATAAT pLKO.1 1205 CDS 100% 13.200 9.240 N DCP2 n/a
5 TRCN0000288954 CCACGGAAACTTCAGGATAAT pLKO_005 1205 CDS 100% 13.200 9.240 N DCP2 n/a
6 TRCN0000310123 GACTGGCTTTCTCGAAGATTT pLKO_005 845 CDS 100% 13.200 9.240 N DCP2 n/a
7 TRCN0000050145 CGAGGAAAGAGACAATGCAAT pLKO.1 214 CDS 100% 4.950 3.465 N DCP2 n/a
8 TRCN0000050147 CTTGGATTTCTACATGCAGAA pLKO.1 274 CDS 100% 4.050 2.835 N DCP2 n/a
9 TRCN0000288888 CTTGGATTTCTACATGCAGAA pLKO_005 274 CDS 100% 4.050 2.835 N DCP2 n/a
10 TRCN0000050146 CCATTCCCTTTATCAGACCAT pLKO.1 819 CDS 100% 2.640 1.848 N DCP2 n/a
11 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 9098 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152624.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13348 pDONR223 100% 91.6% 91.6% None 942_1046del n/a
Download CSV