Transcript: Human NM_152678.3

Homo sapiens DENN domain containing 6A (DENND6A), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DENND6A (201627)
Length:
4646
CDS:
60..1886

Additional Resources:

NCBI RefSeq record:
NM_152678.3
NBCI Gene record:
DENND6A (201627)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138260 CAGGCCGTGGAGGTAATTTAT pLKO.1 285 CDS 100% 15.000 21.000 N DENND6A n/a
2 TRCN0000434693 TGTTATTCTTCGACGCTATTT pLKO_005 1358 CDS 100% 13.200 18.480 N DENND6A n/a
3 TRCN0000135661 GTGGTAATGAAGGTACGGATT pLKO.1 747 CDS 100% 4.050 5.670 N DENND6A n/a
4 TRCN0000433390 GATCAGCAAACTACCTTATAT pLKO_005 584 CDS 100% 15.000 12.000 N DENND6A n/a
5 TRCN0000135923 GATTGGACTTTACCGGCATTT pLKO.1 1562 CDS 100% 10.800 8.640 N DENND6A n/a
6 TRCN0000133753 CCACCTCAATTAAGACAGTTT pLKO.1 1470 CDS 100% 4.950 3.465 N DENND6A n/a
7 TRCN0000135829 CGGAATCATCAGAGACTGTAT pLKO.1 967 CDS 100% 4.950 3.465 N DENND6A n/a
8 TRCN0000136296 GCACAGCTAAACAGTAGCAAA pLKO.1 4233 3UTR 100% 4.950 3.465 N DENND6A n/a
9 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 2676 3UTR 100% 4.950 2.475 Y DENND6A n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3630 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3630 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09818 pDONR223 100% 99.9% 100% None 1029C>G n/a
2 ccsbBroad304_09818 pLX_304 0% 99.9% 100% V5 1029C>G n/a
3 TRCN0000470870 ATCGAAAGGTTTTTACTTCCCAGA pLX_317 19.6% 99.9% 100% V5 1029C>G n/a
Download CSV