Transcript: Human NM_152773.5

Homo sapiens Tctex1 domain containing 2 (TCTEX1D2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TCTEX1D2 (255758)
Length:
625
CDS:
89..517

Additional Resources:

NCBI RefSeq record:
NM_152773.5
NBCI Gene record:
TCTEX1D2 (255758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152773.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196198 GAGCCCGAGAACACCTATATT pLKO.1 158 CDS 100% 15.000 21.000 N TCTEX1D2 n/a
2 TRCN0000433829 TCTGCGTTGTAGCAGCATTTG pLKO_005 480 CDS 100% 10.800 7.560 N TCTEX1D2 n/a
3 TRCN0000155243 GCTGACACTGACAACTATACT pLKO.1 431 CDS 100% 5.625 3.938 N TCTEX1D2 n/a
4 TRCN0000183115 CAAGTAGTGATTGGAGAACAA pLKO.1 368 CDS 100% 4.950 3.465 N TCTEX1D2 n/a
5 TRCN0000432126 ACCTATATTCTGCGGCCTGTT pLKO_005 170 CDS 100% 4.050 2.835 N TCTEX1D2 n/a
6 TRCN0000426068 ATTTGGCTGTTTCTACTACTG pLKO_005 496 CDS 100% 4.050 2.835 N TCTEX1D2 n/a
7 TRCN0000154847 GATGCTGACACTGACAACTAT pLKO.1 428 CDS 100% 5.625 3.375 N TCTEX1D2 n/a
8 TRCN0000143143 CCTCTGTGGTTAAAGACTGTA pLKO.1 210 CDS 100% 4.950 2.475 Y TM4SF19 n/a
9 TRCN0000155598 CCTCTGTGGTTAAAGACTGTA pLKO.1 210 CDS 100% 4.950 2.475 Y TCTEX1D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152773.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09909 pDONR223 100% 99.7% 99.2% None 164A>G n/a
2 ccsbBroad304_09909 pLX_304 0% 99.7% 99.2% V5 164A>G n/a
3 TRCN0000471819 GAACAACTGAGTGAAAACAACTCC pLX_317 87.4% 99.7% 99.2% V5 164A>G n/a
Download CSV