Transcript: Human NM_152774.3

Homo sapiens transmembrane protein 196 (TMEM196), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
TMEM196 (256130)
Length:
3381
CDS:
86..604

Additional Resources:

NCBI RefSeq record:
NM_152774.3
NBCI Gene record:
TMEM196 (256130)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144487 CATGAAATGGCTGAGAAAGAA pLKO.1 527 CDS 100% 5.625 7.313 N TMEM196 n/a
2 TRCN0000341833 CCTGCATCACTCTCATGAAAT pLKO_005 514 CDS 100% 13.200 10.560 N Tmem196 n/a
3 TRCN0000141703 CCAGTTATGAACAGAGGAGGA pLKO.1 471 CDS 100% 2.160 1.728 N TMEM196 n/a
4 TRCN0000143993 CCCAATTCCTTTGGATAACTT pLKO.1 2444 3UTR 100% 5.625 3.938 N TMEM196 n/a
5 TRCN0000143917 CAGTTATGAACAGAGGAGGAT pLKO.1 472 CDS 100% 2.640 1.848 N TMEM196 n/a
6 TRCN0000142407 GAGGATGTTCTCAGAAAGGGA pLKO.1 487 CDS 100% 0.750 0.525 N TMEM196 n/a
7 TRCN0000122786 GCACTCTCTCTTCCTGGCTCA pLKO.1 438 CDS 100% 0.720 0.504 N TMEM196 n/a
8 TRCN0000122729 CTCTCATGAAATGGCTGAGAA pLKO.1 523 CDS 100% 0.495 0.347 N TMEM196 n/a
9 TRCN0000143729 GTTATGAACAGAGGAGGATGT pLKO.1 474 CDS 100% 4.050 2.430 N TMEM196 n/a
10 TRCN0000144530 CCACAGCTGATATTTAATGGA pLKO.1 575 CDS 100% 3.000 1.800 N TMEM196 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13474 pDONR223 100% 51.5% 50% None (many diffs) n/a
2 ccsbBroad304_13474 pLX_304 0% 51.5% 50% V5 (many diffs) n/a
3 TRCN0000467242 TGTCGCACCGGAAGCGTACAAGAA pLX_317 100% 51.5% 50% V5 (many diffs) n/a
Download CSV