Transcript: Mouse NM_152810.2

Mus musculus cell division cycle 5-like (S. pombe) (Cdc5l), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cdc5l (71702)
Length:
2994
CDS:
273..2681

Additional Resources:

NCBI RefSeq record:
NM_152810.2
NBCI Gene record:
Cdc5l (71702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_152810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088242 CCGAAGTGGAACAACTCCTAA pLKO.1 1547 CDS 100% 4.950 6.930 N Cdc5l n/a
2 TRCN0000317164 CCGAAGTGGAACAACTCCTAA pLKO_005 1547 CDS 100% 4.950 6.930 N Cdc5l n/a
3 TRCN0000075019 GCGGTAATGAAATATGGGAAA pLKO.1 336 CDS 100% 4.050 5.670 N CDC5L n/a
4 TRCN0000313605 TCTCGTGAACATCTCCGTTTA pLKO_005 1686 CDS 100% 10.800 8.640 N Cdc5l n/a
5 TRCN0000088240 GCGTTGATTATAATGCTGAAA pLKO.1 892 CDS 100% 4.950 3.960 N Cdc5l n/a
6 TRCN0000088238 CCAGGATAATGAGGGTTTAAA pLKO.1 2845 3UTR 100% 15.000 10.500 N Cdc5l n/a
7 TRCN0000317103 CCAGGATAATGAGGGTTTAAA pLKO_005 2845 3UTR 100% 15.000 10.500 N Cdc5l n/a
8 TRCN0000313559 ATCTCCGTTTAGGGTTGTTAG pLKO_005 1696 CDS 100% 10.800 7.560 N Cdc5l n/a
9 TRCN0000088241 GCCTCATTGCTGCATAGGAAA pLKO.1 375 CDS 100% 4.950 3.465 N Cdc5l n/a
10 TRCN0000088239 CCAACAATTCAGAGCACATTA pLKO.1 2092 CDS 100% 13.200 7.920 N Cdc5l n/a
11 TRCN0000349456 CCAACAATTCAGAGCACATTA pLKO_005 2092 CDS 100% 13.200 7.920 N Cdc5l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05969 pDONR223 100% 89.6% 97.8% None (many diffs) n/a
2 ccsbBroad304_05969 pLX_304 0% 89.6% 97.8% V5 (many diffs) n/a
3 TRCN0000479618 CCACATGGACTGATTTATTGTCTA pLX_317 14.3% 89.6% 97.8% V5 (many diffs) n/a
Download CSV