Transcript: Mouse NM_152824.1

Mus musculus RNA binding motif protein 17 (Rbm17), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rbm17 (76938)
Length:
1583
CDS:
131..1348

Additional Resources:

NCBI RefSeq record:
NM_152824.1
NBCI Gene record:
Rbm17 (76938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_152824.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109084 CATCCAAGAAGTCGGATTCAA pLKO.1 1002 CDS 100% 5.625 7.875 N Rbm17 n/a
2 TRCN0000415482 AGAGCAAGTTTGATTGTAACT pLKO_005 1336 CDS 100% 4.950 6.930 N Rbm17 n/a
3 TRCN0000109082 CCGACGTCTCTTGTAGAGAAA pLKO.1 662 CDS 100% 4.950 6.930 N Rbm17 n/a
4 TRCN0000428007 TACAGTGCTTGCTCCGGTCAT pLKO_005 274 CDS 100% 4.050 3.240 N Rbm17 n/a
5 TRCN0000001201 GATGAAGCAGTACGGATATTT pLKO.1 1190 CDS 100% 15.000 10.500 N RBM17 n/a
6 TRCN0000231430 GATGAAGCAGTACGGATATTT pLKO_005 1190 CDS 100% 15.000 10.500 N RBM17 n/a
7 TRCN0000109083 GTTGGGAAATGTGTGATATTT pLKO.1 1148 CDS 100% 15.000 10.500 N Rbm17 n/a
8 TRCN0000109081 CCGAGATCACAGTCTTCCAAA pLKO.1 728 CDS 100% 4.950 3.465 N Rbm17 n/a
9 TRCN0000438786 GACCAAGCAAAGTACAGTGCT pLKO_005 262 CDS 100% 2.640 1.848 N Rbm17 n/a
10 TRCN0000109080 CCTTGATCCTTACATGAGCTA pLKO.1 1368 3UTR 100% 2.640 1.584 N Rbm17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152824.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14325 pDONR223 100% 89.4% 97.2% None (many diffs) n/a
2 ccsbBroad304_14325 pLX_304 0% 89.4% 97.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000469519 GATAAATCTCCATATCTAGACTGC pLX_317 31.4% 89.4% 97.2% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_09252 pDONR223 100% 89.3% 98.2% None (many diffs) n/a
5 ccsbBroad304_09252 pLX_304 0% 89.3% 98.2% V5 (many diffs) n/a
6 TRCN0000471626 CGACCTCAACTCGATCTCACGAAC pLX_317 43.9% 89.3% 98.2% V5 (many diffs) n/a
Download CSV