Transcript: Human NM_152836.3

Homo sapiens sorting nexin 16 (SNX16), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SNX16 (64089)
Length:
3109
CDS:
161..1195

Additional Resources:

NCBI RefSeq record:
NM_152836.3
NBCI Gene record:
SNX16 (64089)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148623 CCAGTCGGTATGCTTTCTAAA pLKO.1 2454 3UTR 100% 13.200 18.480 N SNX16 n/a
2 TRCN0000147926 GCCAAGTTTAATTGGTGGATT pLKO.1 2191 3UTR 100% 4.950 6.930 N SNX16 n/a
3 TRCN0000130391 GCATGTTACTATCTGGGTGAT pLKO.1 1570 3UTR 100% 4.050 5.670 N SNX16 n/a
4 TRCN0000129013 GAAGAGACAAACTACCGCTTA pLKO.1 860 CDS 100% 4.050 3.240 N SNX16 n/a
5 TRCN0000360088 AGACTCAAATATGGGTAATTT pLKO_005 295 CDS 100% 15.000 10.500 N SNX16 n/a
6 TRCN0000360146 GTTACTATCTGGGTGATATAT pLKO_005 1574 3UTR 100% 15.000 10.500 N SNX16 n/a
7 TRCN0000360147 TATCTCTGACATGACATATTT pLKO_005 1604 3UTR 100% 15.000 10.500 N SNX16 n/a
8 TRCN0000367939 GACAAGTGTTCCTGATCAAAT pLKO_005 322 CDS 100% 13.200 9.240 N SNX16 n/a
9 TRCN0000149902 CAGGGCATTCTGTGAAACTTT pLKO.1 838 CDS 100% 5.625 3.938 N SNX16 n/a
10 TRCN0000129374 GCAGTGTCTCAACAAGCTCAA pLKO.1 252 CDS 100% 4.050 2.835 N SNX16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03919 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03919 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465499 TGATATCTACTCCAGACAAAGCCG pLX_317 18.5% 100% 100% V5 n/a
4 ccsbBroadEn_15131 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_15131 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000473887 ATGCCACCGGACCTGAGAAGATTG pLX_317 41% 100% 100% V5 n/a
Download CSV