Transcript: Human NM_152897.3

Homo sapiens sorting nexin family member 21 (SNX21), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SNX21 (90203)
Length:
1954
CDS:
122..721

Additional Resources:

NCBI RefSeq record:
NM_152897.3
NBCI Gene record:
SNX21 (90203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073333 CCTCACTTCAAGGTTATCAAT pLKO.1 1456 3UTR 100% 5.625 3.938 N SNX21 n/a
2 TRCN0000379513 ACGTCAGGAGAAGACGCAGAA pLKO_005 392 CDS 100% 4.050 2.835 N SNX21 n/a
3 TRCN0000380369 AGTCCAGAGGCCGAGCAGTTT pLKO_005 218 CDS 100% 1.650 1.155 N SNX21 n/a
4 TRCN0000073336 GCCCTCCAAGTACGTGCTCTA pLKO.1 553 CDS 100% 1.350 0.945 N SNX21 n/a
5 TRCN0000073335 GCTGCAGGATTTCTGGAAGAA pLKO.1 463 CDS 100% 4.950 2.970 N SNX21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09290 pDONR223 100% 99.6% 99.4% None 460G>A;594T>C n/a
2 ccsbBroad304_09290 pLX_304 0% 99.6% 99.4% V5 460G>A;594T>C n/a
3 TRCN0000466796 CTTACAATAACTAAGCAGCCCCCG pLX_317 69.2% 99.6% 99.4% V5 460G>A;594T>C n/a
Download CSV