Transcript: Mouse NM_152947.2

Mus musculus ovo like zinc finger 2 (Ovol2), transcript variant B, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ovol2 (107586)
Length:
1214
CDS:
61..786

Additional Resources:

NCBI RefSeq record:
NM_152947.2
NBCI Gene record:
Ovol2 (107586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_152947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085914 CGACAACTCTGTGATTCACAA pLKO.1 297 CDS 100% 4.950 3.960 N Ovol2 n/a
2 TRCN0000085913 GCCACGTTTACTCCGACTTAT pLKO.1 823 3UTR 100% 13.200 9.240 N Ovol2 n/a
3 TRCN0000085916 CATGCTCAACCGTCACCTTAA pLKO.1 354 CDS 100% 10.800 7.560 N Ovol2 n/a
4 TRCN0000421364 CAACAGGCCCTGTGAATTGTT pLKO_005 957 3UTR 100% 5.625 3.938 N Ovol2 n/a
5 TRCN0000433238 TTGGGACAGCAACAGTAAGAA pLKO_005 907 3UTR 100% 5.625 3.938 N Ovol2 n/a
6 TRCN0000085915 GCGACAACTCTGTGATTCACA pLKO.1 296 CDS 100% 3.000 2.100 N Ovol2 n/a
7 TRCN0000085917 CTGCATGTGAACAGTGACCAT pLKO.1 649 CDS 100% 2.640 1.848 N Ovol2 n/a
8 TRCN0000425419 GACCTTTGTGGCAAGAGCTTC pLKO_005 322 CDS 100% 4.050 2.430 N Ovol2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03864 pDONR223 100% 74.5% 77.4% None (many diffs) n/a
2 ccsbBroad304_03864 pLX_304 0% 74.5% 77.4% V5 (many diffs) n/a
3 TRCN0000472531 GCAAGGTGGTGTTTACCTGCATCA pLX_317 45.6% 74.5% 77.4% V5 (many diffs) n/a
Download CSV