Transcript: Human NM_153029.4

Homo sapiens NEDD4 binding protein 1 (N4BP1), mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
N4BP1 (9683)
Length:
7077
CDS:
209..2899

Additional Resources:

NCBI RefSeq record:
NM_153029.4
NBCI Gene record:
N4BP1 (9683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153029.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128563 GCAGTTACTCTTGAGTGTATT pLKO.1 3162 3UTR 100% 13.200 18.480 N N4BP1 n/a
2 TRCN0000277672 GCAGTTACTCTTGAGTGTATT pLKO_005 3162 3UTR 100% 13.200 18.480 N N4BP1 n/a
3 TRCN0000149149 GCTAAGACATTGGCTGGAAAT pLKO.1 1145 CDS 100% 10.800 8.640 N N4BP1 n/a
4 TRCN0000130213 CGTGATCCTAATGTCACAGAA pLKO.1 2210 CDS 100% 4.950 3.960 N N4BP1 n/a
5 TRCN0000277610 CGTGATCCTAATGTCACAGAA pLKO_005 2210 CDS 100% 4.950 3.960 N N4BP1 n/a
6 TRCN0000339340 AGTTACTCTTGAGTGTATTTA pLKO_005 3164 3UTR 100% 15.000 10.500 N N4bp1 n/a
7 TRCN0000277609 GCTCCAGGAGCTCGGAATATT pLKO_005 2248 CDS 100% 15.000 10.500 N N4BP1 n/a
8 TRCN0000285998 CAGGACCTTCTGATCATATTG pLKO_005 1947 CDS 100% 13.200 9.240 N N4BP1 n/a
9 TRCN0000130119 CTGCCTGTTCAGAACTGTTTA pLKO.1 3138 3UTR 100% 13.200 9.240 N N4BP1 n/a
10 TRCN0000285994 CTGCCTGTTCAGAACTGTTTA pLKO_005 3138 3UTR 100% 13.200 9.240 N N4BP1 n/a
11 TRCN0000148248 GACCATCTACTGAACCATTAT pLKO.1 1323 CDS 100% 13.200 9.240 N N4BP1 n/a
12 TRCN0000149763 GCAGCACAAATGAGCTTACAA pLKO.1 1455 CDS 100% 5.625 3.938 N N4BP1 n/a
13 TRCN0000146676 CCCAAGCCAATAAATAGCATT pLKO.1 3896 3UTR 100% 4.950 3.465 N N4BP1 n/a
14 TRCN0000147386 GCAACAGAAACATCACTGTAT pLKO.1 2166 CDS 100% 4.950 3.465 N N4BP1 n/a
15 TRCN0000131131 GCAGAGAGCCTGTTTCTGAAA pLKO.1 488 CDS 100% 4.950 3.465 N N4BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153029.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.