Transcript: Mouse NM_153067.2

Mus musculus MAS-related GPR, member A3 (Mrgpra3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mrgpra3 (233222)
Length:
1295
CDS:
69..1058

Additional Resources:

NCBI RefSeq record:
NM_153067.2
NBCI Gene record:
Mrgpra3 (233222)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176140 GTACTAGATTATAGCCCTCTT pLKO.1 861 CDS 100% 4.050 5.670 N Mrgpra3 n/a
2 TRCN0000176248 GTTGAATAAACAGACCCTCAA pLKO.1 953 CDS 100% 4.050 2.835 N Mrgpra3 n/a
3 TRCN0000175716 GCGGTTACTTAGATAACCATT pLKO.1 598 CDS 100% 0.495 0.347 N Mrgpra3 n/a
4 TRCN0000234301 CCTTCTCTGTCACATCATAAA pLKO_005 332 CDS 100% 13.200 6.600 Y Gm9717 n/a
5 TRCN0000240442 CTTCTTAGTCTACATCCTAAA pLKO_005 287 CDS 100% 10.800 5.400 Y Gm2707 n/a
6 TRCN0000175471 CAGATTATTCGTGACCATCAT pLKO.1 755 CDS 100% 4.950 2.475 Y Mrgpra7 n/a
7 TRCN0000173813 CCTCTCAGCTTACTGACTTGA pLKO.1 1136 3UTR 100% 4.950 2.475 Y Mrgpra3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.