Transcript: Mouse NM_153140.2

Mus musculus RAB11 family interacting protein 3 (class II) (Rab11fip3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rab11fip3 (215445)
Length:
3271
CDS:
201..1535

Additional Resources:

NCBI RefSeq record:
NM_153140.2
NBCI Gene record:
Rab11fip3 (215445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437311 CTCAAACAGGACAACCGTAAC pLKO_005 1272 CDS 100% 6.000 8.400 N Rab11fip3 n/a
2 TRCN0000442398 GAGCTAAATGGGCAGATCATC pLKO_005 1311 CDS 100% 4.950 6.930 N Rab11fip3 n/a
3 TRCN0000421923 TTTCTGCTATGCGCCCTATTA pLKO_005 1867 3UTR 100% 13.200 10.560 N Rab11fip3 n/a
4 TRCN0000420612 GATTGGCAGTGAGGAACATTT pLKO_005 419 CDS 100% 13.200 9.240 N Rab11fip3 n/a
5 TRCN0000435452 TGCTCAGCAGTATGCAGATAT pLKO_005 1813 3UTR 100% 13.200 9.240 N Rab11fip3 n/a
6 TRCN0000427981 GGGCAATGAGGCAGAACTATC pLKO_005 455 CDS 100% 10.800 7.560 N Rab11fip3 n/a
7 TRCN0000421099 GCCCAAGAGAAGGTCCTAGAA pLKO_005 807 CDS 100% 4.950 3.465 N Rab11fip3 n/a
8 TRCN0000429551 ATCAGCTCTGTCTCCCGAGAT pLKO_005 1398 CDS 100% 4.050 2.835 N Rab11fip3 n/a
9 TRCN0000187717 GAAGAGCATTGAGATCGAGAA pLKO.1 872 CDS 100% 4.050 2.835 N Rab11fip3 n/a
10 TRCN0000446761 GCTCATGGAAGCAATCCAGAA pLKO_005 1421 CDS 100% 4.050 2.835 N Rab11fip3 n/a
11 TRCN0000188646 GCAGACAAGGTCATCTTCCTA pLKO.1 651 CDS 100% 3.000 2.100 N Rab11fip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.