Transcript: Human NM_153189.3

Homo sapiens sperm adhesion molecule 1 (SPAM1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
SPAM1 (6677)
Length:
2037
CDS:
431..1960

Additional Resources:

NCBI RefSeq record:
NM_153189.3
NBCI Gene record:
SPAM1 (6677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186143 CCTCAGTATAATGCGAAGTAT pLKO.1 1453 CDS 100% 5.625 7.875 N SPAM1 n/a
2 TRCN0000160836 GCAAGGAGTGTGTATAAGGAA pLKO.1 1579 CDS 100% 3.000 4.200 N SPAM1 n/a
3 TRCN0000163904 CCGGGCAAGGTGTTACAATAT pLKO.1 681 CDS 100% 13.200 10.560 N SPAM1 n/a
4 TRCN0000162350 CGGTTACAATGGAAGTTGCTT pLKO.1 1126 CDS 100% 3.000 2.400 N SPAM1 n/a
5 TRCN0000159105 GCTACTATCCTTACATAGATT pLKO.1 720 CDS 100% 5.625 3.938 N SPAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06987 pDONR223 100% 97.2% 97.2% None (many diffs) n/a
2 ccsbBroad304_06987 pLX_304 0% 97.2% 97.2% V5 (many diffs) n/a
3 TRCN0000491562 GGTCACGCCCGACAAAGTAAGCAA pLX_317 27% 97.2% 97.2% V5 (many diffs) n/a
Download CSV