Transcript: Human NM_153230.3

Homo sapiens F-box protein 39 (FBXO39), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
FBXO39 (162517)
Length:
1685
CDS:
139..1467

Additional Resources:

NCBI RefSeq record:
NM_153230.3
NBCI Gene record:
FBXO39 (162517)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417118 CGAATCAGAGCTTAGCTATTT pLKO_005 1422 CDS 100% 13.200 18.480 N FBXO39 n/a
2 TRCN0000129499 GCGTGTATTCAAGGCGAGAAT pLKO.1 1326 CDS 100% 4.950 6.930 N FBXO39 n/a
3 TRCN0000417606 CCTGGATTATCTCAACCTAAA pLKO_005 627 CDS 100% 10.800 8.640 N FBXO39 n/a
4 TRCN0000425754 AGCTCAACATCGAGGACTATT pLKO_005 728 CDS 100% 13.200 9.240 N FBXO39 n/a
5 TRCN0000128638 CAGCTTGAGCTTCTTCTTAAA pLKO.1 591 CDS 100% 13.200 9.240 N FBXO39 n/a
6 TRCN0000130156 CAGTCTGAGAAGCTGCTATTT pLKO.1 1071 CDS 100% 13.200 9.240 N FBXO39 n/a
7 TRCN0000129014 GAGCACTCTACAGATGAAGAA pLKO.1 1469 3UTR 100% 4.950 3.465 N FBXO39 n/a
8 TRCN0000128969 GCTTGAGAACTTGTGTGAGAA pLKO.1 858 CDS 100% 4.950 3.465 N FBXO39 n/a
9 TRCN0000128850 GATCATGAAGTACGAACGCTT pLKO.1 1011 CDS 100% 2.640 1.848 N FBXO39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09743 pDONR223 100% 99.8% 39.8% None 529G>T;1086C>T n/a
2 ccsbBroad304_09743 pLX_304 0% 99.8% 39.8% V5 (not translated due to prior stop codon) 529G>T;1086C>T n/a
3 TRCN0000470964 CTTGCCCTGACAGATACCACTACT pLX_317 36.5% 99.8% 39.8% V5 (not translated due to prior stop codon) 529G>T;1086C>T n/a
Download CSV