Transcript: Human NM_153267.5

Homo sapiens MAM domain containing 2 (MAMDC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MAMDC2 (256691)
Length:
3351
CDS:
351..2411

Additional Resources:

NCBI RefSeq record:
NM_153267.5
NBCI Gene record:
MAMDC2 (256691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153267.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355760 CACTACAGGCTTAGGGTATTA pLKO_005 1475 CDS 100% 13.200 18.480 N MAMDC2 n/a
2 TRCN0000355761 TCCGTTTGGTCTACCAGATAA pLKO_005 592 CDS 100% 13.200 18.480 N MAMDC2 n/a
3 TRCN0000355759 CCATTCGAGGAGTATCAATAA pLKO_005 2275 CDS 100% 13.200 10.560 N MAMDC2 n/a
4 TRCN0000006974 CCCAATGTGAACTGGTTTGTT pLKO.1 906 CDS 100% 5.625 4.500 N MAMDC2 n/a
5 TRCN0000006973 GCCCTGGATGACATTACAATA pLKO.1 1803 CDS 100% 13.200 9.240 N MAMDC2 n/a
6 TRCN0000006975 GCCATTACATTTATGTGGATA pLKO.1 499 CDS 100% 4.950 3.465 N MAMDC2 n/a
7 TRCN0000006972 GCTAATGAGTTAGTCTGGAAA pLKO.1 2878 3UTR 100% 4.950 3.465 N MAMDC2 n/a
8 TRCN0000006976 GCAAGCTGAAATCACCTTTAA pLKO.1 1715 CDS 100% 13.200 7.920 N MAMDC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153267.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13476 pDONR223 100% 33.8% 33.8% None 1_1362del n/a
2 ccsbBroad304_13476 pLX_304 0% 33.8% 33.8% V5 1_1362del n/a
3 TRCN0000469617 ACGTTGTCTGCGCGAAAAAGGCGG pLX_317 48.7% 33.8% 33.8% V5 1_1362del n/a
Download CSV