Transcript: Human NM_153276.3

Homo sapiens solute carrier family 22 member 6 (SLC22A6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SLC22A6 (9356)
Length:
2127
CDS:
278..1930

Additional Resources:

NCBI RefSeq record:
NM_153276.3
NBCI Gene record:
SLC22A6 (9356)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043257 GCCAAATTGAGTATGGAGGTA pLKO.1 1181 CDS 100% 2.640 3.696 N SLC22A6 n/a
2 TRCN0000412884 CACCGATGGCTGGATCTATGA pLKO_005 592 CDS 100% 4.950 3.960 N SLC22A6 n/a
3 TRCN0000416752 ACCTAATCCAGGTGATCTTTG pLKO_005 1380 CDS 100% 10.800 7.560 N SLC22A6 n/a
4 TRCN0000043255 GCCACTAGCTTTGCATACTAT pLKO.1 1319 CDS 100% 5.625 3.938 N SLC22A6 n/a
5 TRCN0000043256 CCGGAAGGTACTCATCTTGAA pLKO.1 760 CDS 100% 4.950 3.465 N SLC22A6 n/a
6 TRCN0000043254 CCCTTTCTCAATGGCACAGAA pLKO.1 542 CDS 100% 4.950 2.970 N SLC22A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02148 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02148 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467768 TCATTTATGGGGTCACTTTGATGC pLX_317 11.6% 100% 100% V5 n/a
Download CSV