Transcript: Human NM_153341.4

Homo sapiens ring finger protein 19B (RNF19B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
RNF19B (127544)
Length:
2680
CDS:
125..2323

Additional Resources:

NCBI RefSeq record:
NM_153341.4
NBCI Gene record:
RNF19B (127544)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153341.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034089 CGAGGGACAAACTGTCTTGAA pLKO.1 2275 CDS 100% 4.950 6.930 N RNF19B n/a
2 TRCN0000433303 CGATGCAGTGCATACATTATC pLKO_005 989 CDS 100% 13.200 10.560 N RNF19B n/a
3 TRCN0000414972 GACTGCGGTTATGCTGTTATT pLKO_005 752 CDS 100% 13.200 10.560 N RNF19B n/a
4 TRCN0000091695 GCTACCACTGCAAGCAGATAT pLKO.1 837 CDS 100% 13.200 9.240 N Rnf19b n/a
5 TRCN0000334121 GCTACCACTGCAAGCAGATAT pLKO_005 837 CDS 100% 13.200 9.240 N Rnf19b n/a
6 TRCN0000427877 GAGTGACTTTGTCGGTCATTG pLKO_005 1338 CDS 100% 10.800 7.560 N RNF19B n/a
7 TRCN0000034090 CGGTTCCATAATCAGTTCCTA pLKO.1 1834 CDS 100% 3.000 2.100 N RNF19B n/a
8 TRCN0000034091 GCAAGCAGATATGGCATCCAA pLKO.1 846 CDS 100% 3.000 2.100 N RNF19B n/a
9 TRCN0000034093 CCCATTATGCTGGCATATGTT pLKO.1 1400 CDS 100% 0.000 0.000 N RNF19B n/a
10 TRCN0000413406 ACAGCCAGTCTTGGTGCAATT pLKO_005 1784 CDS 100% 10.800 6.480 N RNF19B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153341.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13130 pDONR223 100% 74.8% 74.8% None 1_552del n/a
2 ccsbBroad304_13130 pLX_304 0% 74.8% 74.8% V5 1_552del n/a
Download CSV