Transcript: Human NM_153347.3

Homo sapiens transmembrane protein 86A (TMEM86A), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM86A (144110)
Length:
3607
CDS:
109..831

Additional Resources:

NCBI RefSeq record:
NM_153347.3
NBCI Gene record:
TMEM86A (144110)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153347.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140649 GACCAAGGATACTTCGTGCAT pLKO.1 373 CDS 100% 2.640 3.696 N TMEM86A n/a
2 TRCN0000140148 GATGTTTGCTGTGACCCACAT pLKO.1 402 CDS 100% 4.050 3.240 N TMEM86A n/a
3 TRCN0000144142 CCAGGAGCATTTGTAACTTAA pLKO.1 2438 3UTR 100% 13.200 9.240 N TMEM86A n/a
4 TRCN0000439105 TCAAGGCCACCTGCGTGTATT pLKO_005 164 CDS 100% 13.200 9.240 N TMEM86A n/a
5 TRCN0000433913 AGGACAATGCTGAGAGCTAAA pLKO_005 1011 3UTR 100% 10.800 7.560 N TMEM86A n/a
6 TRCN0000144095 CTTATCATGTCCACCTACTAT pLKO.1 730 CDS 100% 5.625 3.938 N TMEM86A n/a
7 TRCN0000121841 GCCTATGTCTTTCTCTGCTAT pLKO.1 1632 3UTR 100% 4.950 3.465 N TMEM86A n/a
8 TRCN0000140510 GTTTGCTGTGACCCACATGTT pLKO.1 405 CDS 100% 4.950 2.970 N TMEM86A n/a
9 TRCN0000145167 GCACTCTTCTTTATCATCTCA pLKO.1 655 CDS 100% 3.000 1.800 N TMEM86A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153347.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09608 pDONR223 100% 99.8% 99.5% None 710C>A n/a
2 ccsbBroad304_09608 pLX_304 0% 99.8% 99.5% V5 710C>A n/a
3 TRCN0000466559 CCCCAAAAACTATTTTTTATTCCA pLX_317 51.2% 99.8% 99.5% V5 710C>A n/a
Download CSV