Transcript: Human NM_153367.4

Homo sapiens zinc finger CCHC-type containing 24 (ZCCHC24), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ZCCHC24 (219654)
Length:
4930
CDS:
185..910

Additional Resources:

NCBI RefSeq record:
NM_153367.4
NBCI Gene record:
ZCCHC24 (219654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153367.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315354 AGTGCCACATCAACGTGTATC pLKO_005 765 CDS 100% 10.800 15.120 N ZCCHC24 n/a
2 TRCN0000146655 CAACAAAGGACACTACATCAA pLKO.1 598 CDS 100% 4.950 6.930 N ZCCHC24 n/a
3 TRCN0000148931 CAGCTATCTCAACAGCTTCTT pLKO.1 391 CDS 100% 4.950 6.930 N ZCCHC24 n/a
4 TRCN0000315356 GCGAGTACAAGTGTCCCAAGT pLKO_005 687 CDS 100% 4.050 5.670 N ZCCHC24 n/a
5 TRCN0000315355 TTGGCCACAGGTGCACTAAAT pLKO_005 1258 3UTR 100% 13.200 10.560 N ZCCHC24 n/a
6 TRCN0000149193 CATCAACGTGTATCCACACAA pLKO.1 772 CDS 100% 4.950 3.465 N ZCCHC24 n/a
7 TRCN0000315298 CCTGCACTCCAGCTATCTCAA pLKO_005 382 CDS 100% 4.950 3.465 N ZCCHC24 n/a
8 TRCN0000149482 GCTTCAACAAAGGACACTACA pLKO.1 594 CDS 100% 4.950 3.465 N ZCCHC24 n/a
9 TRCN0000350504 ACCCTATGGCTCCCTCAACAA pLKO_005 463 CDS 100% 4.950 2.970 N ZCCHC24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153367.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09842 pDONR223 100% 99.8% 99.5% None 128A>T n/a
2 ccsbBroad304_09842 pLX_304 0% 99.8% 99.5% V5 128A>T n/a
3 TRCN0000468601 TGCGTCCATACAGTAGTGACATTC pLX_317 56.6% 99.8% 99.5% V5 128A>T n/a
Download CSV