Transcript: Mouse NM_153407.2

Mus musculus cysteine-serine-rich nuclear protein 2 (Csrnp2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Csrnp2 (207785)
Length:
4126
CDS:
288..1892

Additional Resources:

NCBI RefSeq record:
NM_153407.2
NBCI Gene record:
Csrnp2 (207785)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124657 CCATAACTCTGTACGCAGCTA pLKO.1 581 CDS 100% 2.640 3.696 N Csrnp2 n/a
2 TRCN0000124656 CCGTCTTACTTGAACAGTGGA pLKO.1 1488 CDS 100% 2.640 3.696 N Csrnp2 n/a
3 TRCN0000124654 GCGTTGACAATGTCAAGCAAA pLKO.1 3783 3UTR 100% 4.950 3.465 N Csrnp2 n/a
4 TRCN0000124655 CACACCAACATCCATCCTGAA pLKO.1 434 CDS 100% 4.050 2.835 N Csrnp2 n/a
5 TRCN0000124658 CCAGGAGTTCATCGCCGAGAA pLKO.1 1202 CDS 100% 1.350 0.945 N Csrnp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04239 pDONR223 100% 85.2% 90.7% None (many diffs) n/a
2 ccsbBroad304_04239 pLX_304 0% 85.2% 90.7% V5 (many diffs) n/a
3 TRCN0000466894 CAACACTGTTCCATAAACGAGCAA pLX_317 19.5% 85.2% 90.7% V5 (many diffs) n/a
Download CSV