Transcript: Human NM_153486.3

Homo sapiens lactate dehydrogenase D (LDHD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
LDHD (197257)
Length:
2096
CDS:
53..1576

Additional Resources:

NCBI RefSeq record:
NM_153486.3
NBCI Gene record:
LDHD (197257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220837 CCTGACGCATATGGACCGAAT pLKO.1 397 CDS 100% 0.000 0.000 N LDHD n/a
2 TRCN0000220836 CAGACCAAGGAGGATCTGAAT pLKO.1 1262 CDS 100% 4.950 3.465 N LDHD n/a
3 TRCN0000220839 CCTCATGAATCCAGGCAAAGT pLKO.1 1549 CDS 100% 4.950 3.465 N LDHD n/a
4 TRCN0000220838 CAACAGGTACAGCAAGCTGAA pLKO.1 982 CDS 100% 4.050 2.835 N LDHD n/a
5 TRCN0000220835 GCCCGCATTGAGTTCCTGGAT pLKO.1 941 CDS 100% 0.880 0.616 N LDHD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05175 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05175 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467686 GGTGCGCCTATGCCGCGCTGGTGC pLX_317 30.3% 100% 100% V5 n/a
Download CSV