Transcript: Mouse NM_153507.2

Mus musculus copine II (Cpne2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cpne2 (234577)
Length:
2328
CDS:
205..1851

Additional Resources:

NCBI RefSeq record:
NM_153507.2
NBCI Gene record:
Cpne2 (234577)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374473 CCTCCTGCCACTCTAAGTATT pLKO_005 2076 3UTR 100% 13.200 18.480 N Cpne2 n/a
2 TRCN0000366085 TGCTACGACTATGACAGTAAT pLKO_005 892 CDS 100% 13.200 18.480 N Cpne2 n/a
3 TRCN0000379079 AGCTCAAGTTCGCCCTGTTTG pLKO_005 473 CDS 100% 10.800 15.120 N Cpne2 n/a
4 TRCN0000366008 ATACACCGAAACTACTCATTC pLKO_005 1072 CDS 100% 10.800 15.120 N Cpne2 n/a
5 TRCN0000111652 GCATCATTATTCTGAGATCAT pLKO.1 1046 CDS 100% 4.950 6.930 N Cpne2 n/a
6 TRCN0000111650 GCTCCCTTTGTCAGAGTCAAT pLKO.1 2016 3UTR 100% 4.950 6.930 N Cpne2 n/a
7 TRCN0000111654 CCAGGTTATGTGCTACGACTA pLKO.1 882 CDS 100% 4.050 5.670 N Cpne2 n/a
8 TRCN0000366083 CATAGGACCGAGGTGATTAAG pLKO_005 784 CDS 100% 13.200 10.560 N Cpne2 n/a
9 TRCN0000379150 CCAGTTGGATGAGCATGATTT pLKO_005 513 CDS 100% 13.200 9.240 N Cpne2 n/a
10 TRCN0000111651 CGACCCTTCTTCTCTCCATTA pLKO.1 1170 CDS 100% 10.800 7.560 N Cpne2 n/a
11 TRCN0000111653 CCTCAGCAAGTAGTGCAGTAT pLKO.1 1786 CDS 100% 4.950 3.465 N Cpne2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05252 pDONR223 100% 88.6% 94.5% None (many diffs) n/a
2 ccsbBroad304_05252 pLX_304 0% 88.6% 94.5% V5 (many diffs) n/a
3 TRCN0000470610 CTAATGAAATACCCCCTTTCCAAG pLX_317 25% 88.6% 94.5% V5 (many diffs) n/a
Download CSV