Transcript: Mouse NM_153508.4

Mus musculus calsyntenin 3 (Clstn3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Clstn3 (232370)
Length:
4007
CDS:
301..3171

Additional Resources:

NCBI RefSeq record:
NM_153508.4
NBCI Gene record:
Clstn3 (232370)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153508.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376772 ATGGCTTCAGCGACCACTTTA pLKO_005 1403 CDS 100% 13.200 18.480 N Clstn3 n/a
2 TRCN0000094573 TGCCCTTTATGCCAGGAAATT pLKO.1 2613 CDS 100% 13.200 18.480 N Clstn3 n/a
3 TRCN0000374943 CACGCATGTCAGATGAGATTG pLKO_005 2384 CDS 100% 10.800 8.640 N Clstn3 n/a
4 TRCN0000094571 CCACTCTTTGCCTTGGATAAA pLKO.1 445 CDS 100% 13.200 9.240 N Clstn3 n/a
5 TRCN0000376703 AGCTGTATGATCGGATCTTAC pLKO_005 773 CDS 100% 10.800 7.560 N Clstn3 n/a
6 TRCN0000364768 ATCCTGAGGCAGGCTCGTTAT pLKO_005 2575 CDS 100% 10.800 7.560 N CLSTN3 n/a
7 TRCN0000374942 CACCGCTGTCAAGTGCTTTAG pLKO_005 2136 CDS 100% 10.800 7.560 N Clstn3 n/a
8 TRCN0000377326 GGGCTGGACTATAGGGATTTC pLKO_005 1954 CDS 100% 10.800 7.560 N CLSTN3 n/a
9 TRCN0000366296 TGCTGATCCACCACTACTTTC pLKO_005 1850 CDS 100% 10.800 7.560 N Clstn3 n/a
10 TRCN0000374944 TTTCTGGTGCTTATGGTTATC pLKO_005 2872 CDS 100% 10.800 7.560 N Clstn3 n/a
11 TRCN0000094570 CCAGGAAATTCCGGCTTTCTT pLKO.1 2624 CDS 100% 5.625 3.938 N Clstn3 n/a
12 TRCN0000094569 CCAAGGTCTTACTGTCTCTAT pLKO.1 3734 3UTR 100% 4.950 3.465 N Clstn3 n/a
13 TRCN0000094572 CCACCACTACTTTCATGGCTA pLKO.1 1857 CDS 100% 2.640 1.848 N Clstn3 n/a
14 TRCN0000366295 GACTCTGCTCTCACCATTATT pLKO_005 2995 CDS 100% 15.000 9.000 N Clstn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153508.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476700 TCCTCAAGAACCATGTATGTCATT pLX_317 11.4% 89.6% 95.5% V5 (many diffs) n/a
Download CSV