Transcript: Mouse NM_153512.1

Mus musculus potassium voltage-gated channel, subfamily G, member 3 (Kcng3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Kcng3 (225030)
Length:
3356
CDS:
278..1579

Additional Resources:

NCBI RefSeq record:
NM_153512.1
NBCI Gene record:
Kcng3 (225030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069387 CAAGTTTAGATCGGCTAGATA pLKO.1 1525 CDS 100% 5.625 7.875 N Kcng3 n/a
2 TRCN0000044024 CCTCCGGGATAATTGAAGCTA pLKO.1 927 CDS 100% 3.000 2.400 N KCNG3 n/a
3 TRCN0000436924 GCCACATGTGGGAACTGTTTA pLKO_005 2043 3UTR 100% 13.200 9.240 N Kcng3 n/a
4 TRCN0000069383 GCTGGAAACTTAGCCTCCTTT pLKO.1 3016 3UTR 100% 4.950 3.465 N Kcng3 n/a
5 TRCN0000069386 GCTCTCCTTCTACAACGAGAT pLKO.1 550 CDS 100% 4.050 2.835 N Kcng3 n/a
6 TRCN0000069385 CCCATCACTTTCATCTACCAT pLKO.1 1478 CDS 100% 3.000 2.100 N Kcng3 n/a
7 TRCN0000069384 CCCTATTACATCTCTGTGCTA pLKO.1 1058 CDS 100% 2.640 1.848 N Kcng3 n/a
8 TRCN0000414700 TTCCCAACTCAAGGGTTAAAG pLKO_005 1706 3UTR 100% 13.200 7.920 N Kcng3 n/a
9 TRCN0000044025 GCTATGGAGATATGTATCCTA pLKO.1 1392 CDS 100% 3.000 1.800 N KCNG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05160 pDONR223 100% 92.7% 95.8% None (many diffs) n/a
2 ccsbBroad304_05160 pLX_304 0% 92.7% 95.8% V5 (many diffs) n/a
3 TRCN0000468853 GAAACTCGACAAAAGGAAATTCAT pLX_317 29.8% 92.7% 95.8% V5 (many diffs) n/a
Download CSV