Transcript: Mouse NM_153562.4

Mus musculus ribosomal RNA adenine dimethylase domain containing 1 (Rrnad1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rrnad1 (229503)
Length:
2847
CDS:
230..1657

Additional Resources:

NCBI RefSeq record:
NM_153562.4
NBCI Gene record:
Rrnad1 (229503)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153562.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336018 TATGCGGAGAGATTACATAAA pLKO_005 1202 CDS 100% 13.200 18.480 N Rrnad1 n/a
2 TRCN0000336080 GGATACCATAACTTCAGATTT pLKO_005 1688 3UTR 100% 13.200 10.560 N Rrnad1 n/a
3 TRCN0000173738 CCTGAACTCTCTCCCAGAAAT pLKO.1 1568 CDS 100% 13.200 9.240 N Rrnad1 n/a
4 TRCN0000336016 CCTGAACTCTCTCCCAGAAAT pLKO_005 1568 CDS 100% 13.200 9.240 N Rrnad1 n/a
5 TRCN0000175962 GACGCCTACATCATCGAATTT pLKO.1 326 CDS 100% 13.200 9.240 N Rrnad1 n/a
6 TRCN0000173368 GAGGACTATGCGGAGAGATTA pLKO.1 1196 CDS 100% 13.200 9.240 N Rrnad1 n/a
7 TRCN0000336017 TATGTGAAACAAGGGTTAAAG pLKO_005 1352 CDS 100% 13.200 9.240 N Rrnad1 n/a
8 TRCN0000194173 GAAACATGTCAAGCCCAAGAA pLKO.1 610 CDS 100% 4.950 3.465 N Rrnad1 n/a
9 TRCN0000174877 GCCAACTCTCTATTTCTTCAA pLKO.1 2258 3UTR 100% 4.950 3.465 N Rrnad1 n/a
10 TRCN0000194067 GCCCAGCAACTTATTAGCTTT pLKO.1 2312 3UTR 100% 4.950 3.465 N Rrnad1 n/a
11 TRCN0000173462 GCTGCTGCTACATGAAACTCA pLKO.1 1080 CDS 100% 3.000 2.100 N Rrnad1 n/a
12 TRCN0000336078 GCTGCTGCTACATGAAACTCA pLKO_005 1080 CDS 100% 3.000 2.100 N Rrnad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153562.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08216 pDONR223 100% 86.2% 86.5% None (many diffs) n/a
2 ccsbBroad304_08216 pLX_304 0% 86.2% 86.5% V5 (many diffs) n/a
Download CSV