Transcript: Mouse NM_153572.2

Mus musculus katanin p60 subunit A-like 1 (Katnal1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Katnal1 (231912)
Length:
6173
CDS:
137..1603

Additional Resources:

NCBI RefSeq record:
NM_153572.2
NBCI Gene record:
Katnal1 (231912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090995 ACGATCTTCATCGACGAAATT pLKO.1 1037 CDS 100% 13.200 18.480 N Katnal1 n/a
2 TRCN0000090997 CAGCACTTTAGAAAGCTTTAA pLKO.1 346 CDS 100% 13.200 9.240 N Katnal1 n/a
3 TRCN0000090993 GCAGGAACTCTTGGAAGAATA pLKO.1 304 CDS 100% 13.200 9.240 N Katnal1 n/a
4 TRCN0000090994 CCACGATCTTCATCGACGAAA pLKO.1 1035 CDS 100% 4.950 3.465 N Katnal1 n/a
5 TRCN0000090996 CCCTCAAATCAGGCGTCCAAA pLKO.1 466 CDS 100% 4.950 3.465 N Katnal1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3778 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04317 pDONR223 100% 85.3% 94.2% None (many diffs) n/a
2 ccsbBroad304_04317 pLX_304 0% 85.3% 94.2% V5 (many diffs) n/a
3 TRCN0000478756 GTTATTTAATCTTCACTGGGCATT pLX_317 23.1% 85.3% 94.2% V5 (many diffs) n/a
Download CSV