Transcript: Mouse NM_153584.2

Mus musculus family with sequence similarity 214, member A (Fam214a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fam214a (235493)
Length:
4196
CDS:
130..3378

Additional Resources:

NCBI RefSeq record:
NM_153584.2
NBCI Gene record:
Fam214a (235493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247168 CTGAATGATCCCGCCATTAAG pLKO_005 484 CDS 100% 13.200 18.480 N Fam214a n/a
2 TRCN0000247169 TCGGTTCTGAACTACCGTTTA pLKO_005 2803 CDS 100% 10.800 15.120 N Fam214a n/a
3 TRCN0000216878 GAAAGCCTCAAACCTAGTAAA pLKO.1 1819 CDS 100% 13.200 10.560 N Fam214a n/a
4 TRCN0000247170 TTGGGCTTCTTTAAGATTAAT pLKO_005 3855 3UTR 100% 15.000 10.500 N Fam214a n/a
5 TRCN0000247171 AGATGCCTTGGATGAGTATTT pLKO_005 165 CDS 100% 13.200 9.240 N Fam214a n/a
6 TRCN0000247167 CGTCAGTGAGAACGTTCAAAT pLKO_005 1145 CDS 100% 13.200 9.240 N Fam214a n/a
7 TRCN0000216250 CTACAGTGTTTCCGATGATAA pLKO.1 2919 CDS 100% 13.200 9.240 N Fam214a n/a
8 TRCN0000196096 GCTGGAAATGCCTGACAGTTT pLKO.1 2238 CDS 100% 4.950 3.465 N Fam214a n/a
9 TRCN0000183469 GTACTGTTGAAACCACTTCAT pLKO.1 3578 3UTR 100% 4.950 3.465 N Fam214a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.