Transcript: Mouse NM_153588.3

Mus musculus MKL/myocardin-like 2 (Mkl2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mkl2 (239719)
Length:
8295
CDS:
219..3461

Additional Resources:

NCBI RefSeq record:
NM_153588.3
NBCI Gene record:
Mkl2 (239719)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153588.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085861 CCCAAGAATCCAAACGACAAA pLKO.1 1026 CDS 100% 4.950 6.930 N Mkl2 n/a
2 TRCN0000085860 CCTCATAAAGAGTGGAGAGAT pLKO.1 2909 CDS 100% 4.950 3.960 N Mkl2 n/a
3 TRCN0000085858 GCCAGTCACAACACTGCATAA pLKO.1 1562 CDS 100% 10.800 7.560 N Mkl2 n/a
4 TRCN0000085859 GCAGTGAAGATAGAGAGTCTT pLKO.1 3166 CDS 100% 4.950 3.465 N Mkl2 n/a
5 TRCN0000085862 CCTTTAATACATCAGATCCTA pLKO.1 2035 CDS 100% 3.000 2.100 N Mkl2 n/a
6 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 7069 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153588.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12353 pDONR223 100% 29.3% 26.1% None (many diffs) n/a
2 ccsbBroad304_12353 pLX_304 0% 29.3% 26.1% V5 (many diffs) n/a
3 TRCN0000467244 CGATCCCTGGTATGATTTCTCTGG pLX_317 31.4% 29.3% 26.1% V5 (many diffs) n/a
Download CSV