Transcript: Mouse NM_153677.2

Mus musculus USH1 protein network component harmonin (Ush1c), transcript variant b3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ush1c (72088)
Length:
3065
CDS:
27..2759

Additional Resources:

NCBI RefSeq record:
NM_153677.2
NBCI Gene record:
Ush1c (72088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080262 GAGTCCCTCAAATGGCAGTAT pLKO.1 558 CDS 100% 4.950 6.930 N Ush1c n/a
2 TRCN0000080259 GCTGGTCATCAATGAACCCAA pLKO.1 167 CDS 100% 2.640 2.112 N Ush1c n/a
3 TRCN0000080258 GTAGGGTTCCATCTCCCATTT pLKO.1 2883 3UTR 100% 10.800 7.560 N Ush1c n/a
4 TRCN0000443842 TAGAGACAGGAGACCAGATTG pLKO_005 781 CDS 100% 10.800 7.560 N Ush1c n/a
5 TRCN0000080261 GACTGGATAGACCTTGTGGTT pLKO.1 2517 CDS 100% 2.640 1.848 N Ush1c n/a
6 TRCN0000080260 GACCAGATTGTGGAAGTCAAT pLKO.1 792 CDS 100% 4.950 3.465 N Ush1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14038 pDONR223 100% 51.9% 54.6% None (many diffs) n/a
2 ccsbBroad304_14038 pLX_304 0% 51.9% 54.6% V5 (many diffs) n/a
3 TRCN0000465750 CAATCGATTGGTATATCGAAATTC pLX_317 23.4% 51.9% 54.6% V5 (many diffs) n/a
Download CSV