Transcript: Human NM_153714.3

Homo sapiens chromosome 10 open reading frame 67 (C10orf67), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
C10orf67 (256815)
Length:
2901
CDS:
21..578

Additional Resources:

NCBI RefSeq record:
NM_153714.3
NBCI Gene record:
C10orf67 (256815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263840 GGTCCACGAGACTTAACATTT pLKO_005 220 CDS 100% 13.200 18.480 N C10orf67 n/a
2 TRCN0000263838 AGTTTGAGGACCGACTGAAAG pLKO_005 406 CDS 100% 10.800 15.120 N C10orf67 n/a
3 TRCN0000282828 ATGTCATGAGCATAGTTATTA pLKO_005 55 CDS 100% 15.000 10.500 N C10orf67 n/a
4 TRCN0000263839 ATGACAGGATCCTAGAAATTG pLKO_005 457 CDS 100% 13.200 9.240 N C10orf67 n/a
5 TRCN0000167089 CATAGCTGTTATCAAAGGAAT pLKO.1 542 CDS 100% 4.950 3.465 N C10orf67 n/a
6 TRCN0000168603 GCCTTAAACTTCTGGACTCAA pLKO.1 1449 3UTR 100% 4.950 3.465 N C10orf67 n/a
7 TRCN0000167066 CATTATCAACAGAATGAGGAT pLKO.1 483 CDS 100% 2.640 1.848 N C10orf67 n/a
8 TRCN0000263841 CCACTGTGCTGGCCTAATTAA pLKO_005 1658 3UTR 100% 15.000 9.000 N C10orf67 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10482 pDONR223 100% 99.2% 99.4% None 1_3delATG;141G>T n/a
2 ccsbBroad304_10482 pLX_304 0% 99.2% 99.4% V5 1_3delATG;141G>T n/a
3 TRCN0000476993 ATCGTGGTGGTCAGCATTATGGTG pLX_317 73.2% 99.2% 99.4% V5 1_3delATG;141G>T n/a
Download CSV