Transcript: Mouse NM_153762.3

Mus musculus ring finger protein 26 (Rnf26), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rnf26 (213211)
Length:
2294
CDS:
103..1377

Additional Resources:

NCBI RefSeq record:
NM_153762.3
NBCI Gene record:
Rnf26 (213211)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421555 GAGTAACACTTTCTCTAAATC pLKO_005 1561 3UTR 100% 13.200 9.240 N Rnf26 n/a
2 TRCN0000429845 GGTTTGGATCTTGAACCTTTA pLKO_005 1855 3UTR 100% 10.800 7.560 N Rnf26 n/a
3 TRCN0000040834 CATCCTGAACATGGTCTCCAA pLKO.1 456 CDS 100% 2.640 1.848 N Rnf26 n/a
4 TRCN0000040835 TGGAAGCTGTTGAAGGAGCAA pLKO.1 1177 CDS 100% 2.640 1.848 N Rnf26 n/a
5 TRCN0000040836 GCTTGCGTGCTGGCAGTGATT pLKO.1 805 CDS 100% 1.650 1.155 N Rnf26 n/a
6 TRCN0000040837 CCACAGGACACTCCTCCTGAA pLKO.1 1072 CDS 100% 0.135 0.081 N Rnf26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08921 pDONR223 100% 83.6% 86.8% None (many diffs) n/a
2 ccsbBroad304_08921 pLX_304 0% 83.6% 86.8% V5 (many diffs) n/a
3 TRCN0000491453 CGCCTTTATCGAGCTGTTGGCGCA pLX_317 24.5% 83.6% 86.8% V5 (many diffs) n/a
Download CSV