Transcript: Mouse NM_153820.3

Mus musculus Rho GTPase activating protein 15 (Arhgap15), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Arhgap15 (76117)
Length:
2663
CDS:
66..1511

Additional Resources:

NCBI RefSeq record:
NM_153820.3
NBCI Gene record:
Arhgap15 (76117)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177416 GATTGTTCTTTCTGGTCGAAA pLKO.1 407 CDS 100% 4.950 6.930 N Arhgap15 n/a
2 TRCN0000176755 CCAAACTAAATCCATGATCCT pLKO.1 206 CDS 100% 2.640 3.696 N Arhgap15 n/a
3 TRCN0000177745 CCACTAGAACATCCAATGGTT pLKO.1 309 CDS 100% 3.000 2.400 N Arhgap15 n/a
4 TRCN0000198324 GCTGACTGAGTACGATAAGAT pLKO.1 1469 CDS 100% 5.625 3.938 N Arhgap15 n/a
5 TRCN0000176672 CATGTGTTGAAAGATGTCATT pLKO.1 285 CDS 100% 4.950 3.465 N Arhgap15 n/a
6 TRCN0000197579 GAATCATTCACAGCATGTGTT pLKO.1 272 CDS 100% 4.950 3.465 N Arhgap15 n/a
7 TRCN0000177133 GAGTATGTTCACATCTGTCTT pLKO.1 1530 3UTR 100% 4.950 3.465 N Arhgap15 n/a
8 TRCN0000197586 CTTCCTCATATTGGATTGGTT pLKO.1 611 CDS 100% 3.000 2.100 N Arhgap15 n/a
9 TRCN0000429280 GGAAGGTCACTGAACCTATAT pLKO_005 238 CDS 100% 13.200 9.240 N ARHGAP15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08597 pDONR223 100% 86.6% 84.8% None (many diffs) n/a
2 ccsbBroad304_08597 pLX_304 0% 86.6% 84.8% V5 (many diffs) n/a
3 TRCN0000474228 GGCGATTCGTACCCTCACTGGCGC pLX_317 39.5% 86.6% 84.8% V5 (many diffs) n/a
Download CSV