Transcript: Human NM_153839.7

Homo sapiens adhesion G protein-coupled receptor F2 (ADGRF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ADGRF2 (222611)
Length:
5241
CDS:
395..2323

Additional Resources:

NCBI RefSeq record:
NM_153839.7
NBCI Gene record:
ADGRF2 (222611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153839.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368469 CCAGGAAACATTGCCGTAATT pLKO_005 812 CDS 100% 13.200 18.480 N ADGRF2 n/a
2 TRCN0000368468 ACGCCATGTGTGCATTGTTAA pLKO_005 1639 CDS 100% 13.200 10.560 N ADGRF2 n/a
3 TRCN0000368687 TTTGGCCATCGTGGTAGTAAA pLKO_005 2023 CDS 100% 13.200 10.560 N ADGRF2 n/a
4 TRCN0000011525 GCACCACCATATCTGGAGATA pLKO.1 1071 CDS 100% 4.950 3.960 N ADGRF2 n/a
5 TRCN0000357071 GCATTGCATTTCCAACTATTG pLKO_005 1212 CDS 100% 10.800 7.560 N ADGRF2 n/a
6 TRCN0000011524 GCAGCTATATCCTGCTACATT pLKO.1 972 CDS 100% 5.625 3.938 N ADGRF2 n/a
7 TRCN0000011527 CACATCTTAGAGAGTCTGATT pLKO.1 1505 CDS 100% 4.950 3.465 N ADGRF2 n/a
8 TRCN0000011523 GCCGTAATTGTGCAGCTCTTA pLKO.1 824 CDS 100% 4.950 3.465 N ADGRF2 n/a
9 TRCN0000011526 CCAGCCTGTGATTTGTAGCAA pLKO.1 102 5UTR 100% 3.000 2.100 N ADGRF2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 262 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 262 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153839.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491428 GCAAGATTTCGAATTCACCCCTCC pLX_317 25% 62.8% 60.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV