Transcript: Mouse NM_170591.1

Mus musculus nucleoporin like 1 (Nupl1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nupl1 (71844)
Length:
2410
CDS:
110..1873

Additional Resources:

NCBI RefSeq record:
NM_170591.1
NBCI Gene record:
Nupl1 (71844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_170591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366386 GCCGCACAACTTCAATCTATT pLKO_005 1271 CDS 100% 13.200 18.480 N Nupl1 n/a
2 TRCN0000366450 TGCCACTCAAGCCAGTAATTC pLKO_005 1186 CDS 100% 13.200 10.560 N Nupl1 n/a
3 TRCN0000366448 ACAGGCCTCTTTGGATCTAAG pLKO_005 302 CDS 100% 10.800 8.640 N Nupl1 n/a
4 TRCN0000013515 CCTCCACATTTGGATTTGGAA pLKO.1 1650 CDS 100% 3.000 2.400 N NUP58 n/a
5 TRCN0000125558 CAGGAGTTAAAGAATGCCGAA pLKO.1 1022 CDS 100% 2.160 1.728 N Nupl1 n/a
6 TRCN0000375075 TGCATCTCGGGAGATTTATAA pLKO_005 1958 3UTR 100% 15.000 10.500 N Nupl1 n/a
7 TRCN0000366385 ATGATCTATCCTAGTACTAAT pLKO_005 2158 3UTR 100% 13.200 9.240 N Nupl1 n/a
8 TRCN0000375127 CTTTAGTACCTCATCAGATAA pLKO_005 733 CDS 100% 13.200 9.240 N Nupl1 n/a
9 TRCN0000366447 GAGTTAAAGAATGCCGAAATA pLKO_005 1025 CDS 100% 13.200 9.240 N Nupl1 n/a
10 TRCN0000375128 GCTGACTACTTCAGAATATTG pLKO_005 1100 CDS 100% 13.200 9.240 N Nupl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02251 pDONR223 100% 88.7% 90.8% None (many diffs) n/a
2 ccsbBroad304_02251 pLX_304 0% 88.7% 90.8% V5 (many diffs) n/a
3 TRCN0000471985 CCTTGGGCCGGACTCTACTATTCT pLX_317 19.5% 88.7% 90.8% V5 (many diffs) n/a
Download CSV