Transcript: Human NM_170664.3

Homo sapiens otoancorin (OTOA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
OTOA (146183)
Length:
2704
CDS:
68..2515

Additional Resources:

NCBI RefSeq record:
NM_170664.3
NBCI Gene record:
OTOA (146183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_170664.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430709 ATCATCTTGTCTGCCAAATAC pLKO_005 380 CDS 100% 13.200 9.240 N OTOA n/a
2 TRCN0000118992 GCGTGGAAATACTGGGAAGTT pLKO.1 914 CDS 100% 4.950 3.465 N OTOA n/a
3 TRCN0000118994 GCTCTGTTCCTGTATGAGCTT pLKO.1 725 CDS 100% 2.640 1.848 N OTOA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170664.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09625 pDONR223 100% 71.4% 71.2% None 0_1ins972;3_5delGTTinsCCA;2102A>C n/a
2 ccsbBroad304_09625 pLX_304 0% 71.4% 71.2% V5 0_1ins972;3_5delGTTinsCCA;2102A>C n/a
3 TRCN0000465295 CAGCAGTATATACTTAGGCTTGGT pLX_317 5% 71.4% 71.2% V5 0_1ins972;3_5delGTTinsCCA;2102A>C n/a
Download CSV