Transcript: Human NM_171828.2

Homo sapiens potassium calcium-activated channel subfamily M regulatory beta subunit 3 (KCNMB3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
KCNMB3 (27094)
Length:
1314
CDS:
341..1174

Additional Resources:

NCBI RefSeq record:
NM_171828.2
NBCI Gene record:
KCNMB3 (27094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_171828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044369 GCTCGGAACAACCATTCTAAA pLKO.1 559 CDS 100% 13.200 10.560 N KCNMB3 n/a
2 TRCN0000044372 GATGGGCTTCTCAGTCCTAAT pLKO.1 529 CDS 100% 10.800 8.640 N KCNMB3 n/a
3 TRCN0000428772 CTTAAGACGGTGGCCAAATTA pLKO_005 1170 CDS 100% 15.000 10.500 N KCNMB3 n/a
4 TRCN0000428981 GAAAGCTCTCCTACATTATAA pLKO_005 745 CDS 100% 15.000 10.500 N KCNMB3 n/a
5 TRCN0000436767 ACCCGTGTCTTCAGGTGTTTG pLKO_005 702 CDS 100% 10.800 7.560 N KCNMB3 n/a
6 TRCN0000044368 GCCACCAAGATAGAAATGATT pLKO.1 813 CDS 100% 5.625 3.938 N KCNMB3 n/a
7 TRCN0000044371 CCAGATAAATCCCAAGTGCTT pLKO.1 778 CDS 100% 2.640 1.848 N KCNMB3 n/a
8 TRCN0000044370 GCATCAGTTCAAACTGTGCAT pLKO.1 1117 CDS 100% 2.640 1.848 N KCNMB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_171828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.