Transcript: Mouse NM_172144.3

Mus musculus protein phosphatase 2, regulatory subunit B'', alpha (Ppp2r3a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-08
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r3a (235542)
Length:
4778
CDS:
312..1904

Additional Resources:

NCBI RefSeq record:
NM_172144.3
NBCI Gene record:
Ppp2r3a (235542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172144.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081395 CCACGGTTGTTCAGAGAATAT pLKO.1 988 CDS 100% 13.200 18.480 N Ppp2r3a n/a
2 TRCN0000081393 CCTTGAACTTACCTGGTTTAA pLKO.1 2384 3UTR 100% 13.200 9.240 N Ppp2r3a n/a
3 TRCN0000081394 GCTCATTTGAAGACTATGAAT pLKO.1 1777 CDS 100% 5.625 3.938 N Ppp2r3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172144.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06760 pDONR223 100% 40.2% 38.8% None (many diffs) n/a
2 ccsbBroad304_06760 pLX_304 0% 40.2% 38.8% V5 (many diffs) n/a
Download CSV