Transcript: Human NM_172160.2

Homo sapiens potassium voltage-gated channel subfamily A member regulatory beta subunit 1 (KCNAB1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KCNAB1 (7881)
Length:
3715
CDS:
65..1324

Additional Resources:

NCBI RefSeq record:
NM_172160.2
NBCI Gene record:
KCNAB1 (7881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044790 GCTGTCAAGAAAGCATATTAT pLKO.1 610 CDS 100% 15.000 10.500 N KCNAB1 n/a
2 TRCN0000044788 CGCCTATGAAAGTGGTGTTAA pLKO.1 445 CDS 100% 13.200 9.240 N KCNAB1 n/a
3 TRCN0000044791 CCAGTGGTTGAAAGAAAGAAT pLKO.1 1030 CDS 100% 5.625 3.938 N KCNAB1 n/a
4 TRCN0000044792 CTCCTGAACAACTCATTGAAA pLKO.1 1197 CDS 100% 5.625 3.938 N KCNAB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07185 pDONR223 100% 87.7% 82.1% None (many diffs) n/a
2 ccsbBroad304_07185 pLX_304 0% 87.7% 82.1% V5 (many diffs) n/a
3 TRCN0000472464 CGGGTAAACTCCGGGTTGATGAAA pLX_317 27.2% 87.7% 82.1% V5 (many diffs) n/a
Download CSV