Transcript: Human NM_172240.3

Homo sapiens POC1 centriolar protein B (POC1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POC1B (282809)
Length:
3024
CDS:
153..1589

Additional Resources:

NCBI RefSeq record:
NM_172240.3
NBCI Gene record:
POC1B (282809)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077996 GCGGTGGAGTTAATTGCATAT pLKO.1 835 CDS 100% 10.800 15.120 N POC1B n/a
2 TRCN0000426451 AGTTGAGACTGTAGAAATTAA pLKO_005 1169 CDS 100% 15.000 10.500 N POC1B n/a
3 TRCN0000435327 GCAGACACACAGGTCTTATTA pLKO_005 1020 CDS 100% 15.000 10.500 N POC1B n/a
4 TRCN0000425473 GCATACCTAAGGACTAATTTA pLKO_005 1749 3UTR 100% 15.000 10.500 N POC1B n/a
5 TRCN0000430683 TTCCGTTGGATTTGCAAATTT pLKO_005 704 CDS 100% 15.000 10.500 N POC1B n/a
6 TRCN0000077993 GCCTTGAAAGAATGAACAAAT pLKO.1 2093 3UTR 100% 13.200 9.240 N POC1B n/a
7 TRCN0000432927 GTATTCCTTGTATCGACATAC pLKO_005 563 CDS 100% 10.800 7.560 N POC1B n/a
8 TRCN0000077997 CCACAAATAAGCAATGTGTTA pLKO.1 670 CDS 100% 4.950 3.465 N POC1B n/a
9 TRCN0000077994 CCTTCCTTAATGTCACCAGAA pLKO.1 1332 CDS 100% 4.050 2.835 N POC1B n/a
10 TRCN0000077995 GCGTTATTTCAAAGGCCACAA pLKO.1 185 CDS 100% 4.050 2.025 Y POC1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05343 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05343 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481326 TACTACCCGCTTTAATTGCCCTGT pLX_317 28% 100% 100% V5 n/a
Download CSV