Transcript: Mouse NM_172256.1

Mus musculus dynein cytoplasmic 2 light intermediate chain 1 (Dync2li1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Dync2li1 (213575)
Length:
1378
CDS:
83..1138

Additional Resources:

NCBI RefSeq record:
NM_172256.1
NBCI Gene record:
Dync2li1 (213575)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248420 CCCAATCGAGGAAGATTATTT pLKO_005 1170 3UTR 100% 15.000 21.000 N Dync2li1 n/a
2 TRCN0000248422 TCCAATACCTCTGGTCATTAT pLKO_005 613 CDS 100% 13.200 10.560 N Dync2li1 n/a
3 TRCN0000248424 ACCATCCGGACCGGGAATTAA pLKO_005 582 CDS 100% 15.000 10.500 N Dync2li1 n/a
4 TRCN0000179244 GCCATGTAGACAAGGTGATAA pLKO.1 489 CDS 100% 13.200 9.240 N Dync2li1 n/a
5 TRCN0000248423 GTCGACACCTTAAGGACATTT pLKO_005 389 CDS 100% 13.200 9.240 N Dync2li1 n/a
6 TRCN0000248421 CTGCGCTTTGTGGCACATTAC pLKO_005 698 CDS 100% 10.800 7.560 N Dync2li1 n/a
7 TRCN0000183244 GTGAAGAAAGTTGAGCGTATA pLKO.1 1212 3UTR 100% 10.800 7.560 N Dync2li1 n/a
8 TRCN0000179062 CCAGGAACTAGAACACTACAA pLKO.1 1072 CDS 100% 4.950 3.465 N Dync2li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03348 pDONR223 100% 83.7% 87.5% None (many diffs) n/a
2 ccsbBroad304_03348 pLX_304 0% 83.7% 87.5% V5 (many diffs) n/a
3 TRCN0000467560 TGTTCAGGGGAATGGGGGAGAGGC pLX_317 30.2% 83.7% 87.5% V5 (many diffs) n/a
Download CSV