Transcript: Mouse NM_172289.4

Mus musculus solute carrier family 36 (proton/amino acid symporter), member 4 (Slc36a4), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Slc36a4 (234967)
Length:
1937
CDS:
24..1526

Additional Resources:

NCBI RefSeq record:
NM_172289.4
NBCI Gene record:
Slc36a4 (234967)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172289.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068417 GAGGTTTAAGAAGTCAACATT pLKO.1 371 CDS 100% 5.625 3.938 N Slc36a4 n/a
2 TRCN0000068414 CGCGAGCTGAAGAATCTCTTT pLKO.1 693 CDS 100% 4.950 3.465 N Slc36a4 n/a
3 TRCN0000068413 GCCCTTAATAAACGAGCAGAA pLKO.1 86 CDS 100% 4.050 2.835 N Slc36a4 n/a
4 TRCN0000068415 CCTAGCCACTTTAGGCTACAT pLKO.1 974 CDS 100% 0.495 0.347 N Slc36a4 n/a
5 TRCN0000068416 CCTTTCTGAATGTGAACTCTA pLKO.1 1483 CDS 100% 4.950 2.970 N Slc36a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172289.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09464 pDONR223 100% 82.5% 87.8% None (many diffs) n/a
2 ccsbBroad304_09464 pLX_304 0% 82.5% 87.8% V5 (many diffs) n/a
3 TRCN0000467203 ACGATTAAAGCTCTTAACATGTAT pLX_317 17.3% 82.5% 87.8% V5 (many diffs) n/a
Download CSV