Transcript: Mouse NM_172310.2

Mus musculus threonyl-tRNA synthetase-like 2 (Tarsl2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tarsl2 (272396)
Length:
3194
CDS:
48..2420

Additional Resources:

NCBI RefSeq record:
NM_172310.2
NBCI Gene record:
Tarsl2 (272396)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102460 GCGAGAATTATCAGAAATCAT pLKO.1 2694 3UTR 100% 5.625 7.875 N Tarsl2 n/a
2 TRCN0000102461 CGCTGGAATTAGTAAGGAATT pLKO.1 566 CDS 100% 0.000 0.000 N Tarsl2 n/a
3 TRCN0000102463 CCATTGATTGACCTTTGTAAA pLKO.1 1014 CDS 100% 13.200 9.240 N Tarsl2 n/a
4 TRCN0000102462 GCCTGTTAGATTTGCTGATTT pLKO.1 1538 CDS 100% 13.200 9.240 N Tarsl2 n/a
5 TRCN0000102464 GCAGCATTACAGTAACAACAT pLKO.1 1415 CDS 100% 4.950 3.465 N Tarsl2 n/a
6 TRCN0000159368 GAGATTGAGATATGGGATGAT pLKO.1 1770 CDS 100% 4.950 2.475 Y CTNNA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15234 pDONR223 94.8% 84.3% 85.2% None (many diffs) n/a
2 ccsbBroad304_15234 pLX_304 0% 84.3% 85.2% V5 (many diffs) n/a
3 TRCN0000478213 GTCCGAAATCGGCCCAATGCGAAA pLX_317 12.7% 84.3% 85.2% V5 (many diffs) n/a
Download CSV