Transcript: Human NM_172364.5

Homo sapiens calcium voltage-gated channel auxiliary subunit alpha2delta 4 (CACNA2D4), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CACNA2D4 (93589)
Length:
5285
CDS:
180..3593

Additional Resources:

NCBI RefSeq record:
NM_172364.5
NBCI Gene record:
CACNA2D4 (93589)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172364.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230579 GTGAAGGTTCCGATGGATAAA pLKO_005 2034 CDS 100% 13.200 18.480 N CACNA2D4 n/a
2 TRCN0000044397 CCTGGTGTTCGACTATTACAA pLKO.1 659 CDS 100% 5.625 7.875 N CACNA2D4 n/a
3 TRCN0000044393 GCGTACAATGACTACGTCCAT pLKO.1 1170 CDS 100% 2.640 3.696 N CACNA2D4 n/a
4 TRCN0000230578 CAACGTTGACCTGGCAATATT pLKO_005 904 CDS 100% 15.000 10.500 N CACNA2D4 n/a
5 TRCN0000218582 CAGGATCTATCCAGGTATAAA pLKO_005 947 CDS 100% 15.000 10.500 N CACNA2D4 n/a
6 TRCN0000044395 GCGACAGAAGTCAAATATAAT pLKO.1 3390 CDS 100% 15.000 10.500 N CACNA2D4 n/a
7 TRCN0000230580 TCGACAACAACGGGTTCATTC pLKO_005 2857 CDS 100% 10.800 7.560 N CACNA2D4 n/a
8 TRCN0000044396 CCTGACCAATGACTACTTCTT pLKO.1 2072 CDS 100% 4.950 3.465 N CACNA2D4 n/a
9 TRCN0000044394 GCCAGTCTTCAGCAAGAAGAA pLKO.1 1715 CDS 100% 0.495 0.347 N CACNA2D4 n/a
10 TRCN0000219061 TGCTAGAACAGCTAAGGTTTA pLKO_005 5046 3UTR 100% 10.800 6.480 N CACNA2D4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172364.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12998 pDONR223 100% 17.9% 17.9% None 1_2799del n/a
2 ccsbBroad304_12998 pLX_304 0% 17.9% 17.9% V5 1_2799del n/a
3 TRCN0000467043 CTCTCAGATTCCCATTCCCCGGAA pLX_317 42.4% 17.9% 17.9% V5 1_2799del n/a
Download CSV