Transcript: Mouse NM_172397.3

Mus musculus LIM domain containing 2 (Limd2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Limd2 (67803)
Length:
2950
CDS:
146..532

Additional Resources:

NCBI RefSeq record:
NM_172397.3
NBCI Gene record:
Limd2 (67803)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112948 GCTGCAATGCACGGTGAATTT pLKO.1 386 CDS 100% 13.200 18.480 N Limd2 n/a
2 TRCN0000112949 GTTTGGTCGTAAACAGCACAA pLKO.1 463 CDS 100% 4.050 5.670 N Limd2 n/a
3 TRCN0000112946 GCGGTCTAAGTCCTTTAGCTT pLKO.1 223 CDS 100% 3.000 4.200 N Limd2 n/a
4 TRCN0000271874 ACGACAAAGCCTTGGATTTAT pLKO_005 2042 3UTR 100% 15.000 10.500 N Limd2 n/a
5 TRCN0000271924 CAGGACCCTTCTGATATAAAT pLKO_005 2542 3UTR 100% 15.000 10.500 N Limd2 n/a
6 TRCN0000271876 TCGGTTCTTCAGAGGTTAATT pLKO_005 1502 3UTR 100% 15.000 10.500 N Limd2 n/a
7 TRCN0000271879 TCAGTCAAGATATAGTCAATA pLKO_005 2614 3UTR 100% 13.200 9.240 N Limd2 n/a
8 TRCN0000112947 GCTGTTTAAGAGTAAAGGCAA pLKO.1 430 CDS 100% 2.640 1.848 N Limd2 n/a
9 TRCN0000271880 CTAGTCCTTTACCCTAGAAAT pLKO_005 1617 3UTR 100% 0.000 0.000 N Limd2 n/a
10 TRCN0000112945 GCCTGTTCTATGTAGTGAGTT pLKO.1 2185 3UTR 100% 4.950 2.970 N Limd2 n/a
11 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 1454 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04223 pDONR223 100% 89% 95.3% None (many diffs) n/a
2 ccsbBroad304_04223 pLX_304 0% 89% 95.3% V5 (many diffs) n/a
3 TRCN0000466800 CTACGCCTAACAATAGCTAGTCAG pLX_317 68.5% 89% 95.3% V5 (many diffs) n/a
Download CSV