Transcript: Mouse NM_172438.3

Mus musculus THO complex 5 (Thoc5), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Thoc5 (107829)
Length:
2235
CDS:
57..2108

Additional Resources:

NCBI RefSeq record:
NM_172438.3
NBCI Gene record:
Thoc5 (107829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420904 TCTACTACCTGGCGCTAATTG pLKO_005 1705 CDS 100% 13.200 18.480 N Thoc5 n/a
2 TRCN0000123770 CCAACAAACATTGGCACGTTT pLKO.1 608 CDS 100% 4.950 6.930 N Thoc5 n/a
3 TRCN0000123773 CGATGACAATATTCGGGCTAT pLKO.1 1838 CDS 100% 4.050 5.670 N Thoc5 n/a
4 TRCN0000123769 CCTGGTAAAGTGGGTGATAAT pLKO.1 1610 CDS 100% 13.200 9.240 N Thoc5 n/a
5 TRCN0000424254 CAAATCCAGCCAATCAGTATC pLKO_005 1297 CDS 100% 10.800 7.560 N Thoc5 n/a
6 TRCN0000123772 AGGTTGTTTCTCGCCTGGTAA pLKO.1 1597 CDS 100% 4.950 3.465 N Thoc5 n/a
7 TRCN0000000111 CCAGCCAATCAGTATCAGTTT pLKO.1 1302 CDS 100% 4.950 3.465 N THOC5 n/a
8 TRCN0000272543 CCAGCCAATCAGTATCAGTTT pLKO_005 1302 CDS 100% 4.950 3.465 N THOC5 n/a
9 TRCN0000123771 CCATTGAAATTGAAGAACGAA pLKO.1 298 CDS 100% 3.000 2.100 N Thoc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07264 pDONR223 99.5% 89.7% 96% None (many diffs) n/a
2 ccsbBroad304_07264 pLX_304 0% 89.7% 96% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV