Transcript: Mouse NM_172472.3

Mus musculus transcription factor E3 (Tfe3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tfe3 (209446)
Length:
3293
CDS:
285..2003

Additional Resources:

NCBI RefSeq record:
NM_172472.3
NBCI Gene record:
Tfe3 (209446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172472.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084670 GTGGATTACATCCGCAAATTA pLKO.1 1458 CDS 100% 15.000 21.000 N Tfe3 n/a
2 TRCN0000434364 ACATTAACGATAGGATCAAAG pLKO_005 1363 CDS 100% 10.800 15.120 N Tfe3 n/a
3 TRCN0000084668 GCCACTAGAGATCCTTAGAAA pLKO.1 2296 3UTR 100% 5.625 7.875 N Tfe3 n/a
4 TRCN0000084669 GCCTAACATCAAACGCGAGAT pLKO.1 1259 CDS 100% 4.050 5.670 N Tfe3 n/a
5 TRCN0000084672 GCCCTTCTGGACCTACACTTT pLKO.1 1773 CDS 100% 4.950 3.960 N Tfe3 n/a
6 TRCN0000416909 ATCCGGGATTGTTGCTGATAT pLKO_005 422 CDS 100% 13.200 9.240 N Tfe3 n/a
7 TRCN0000084671 TGTGGATTACATCCGCAAATT pLKO.1 1457 CDS 100% 13.200 9.240 N Tfe3 n/a
8 TRCN0000433747 ACCTAGGGCTAGAGGACATTC pLKO_005 1831 CDS 100% 10.800 7.560 N Tfe3 n/a
9 TRCN0000433246 AGCCAGAACAGCTGGACATTG pLKO_005 1660 CDS 100% 10.800 7.560 N Tfe3 n/a
10 TRCN0000431654 AGCTATCACCGTCAGCAATTC pLKO_005 1223 CDS 100% 10.800 7.560 N Tfe3 n/a
11 TRCN0000232153 AGGAGATTGATGATGTCATTG pLKO_005 1057 CDS 100% 10.800 7.560 N TFE3 n/a
12 TRCN0000232154 GCCTGGAGTCCAGTTACAATG pLKO_005 1090 CDS 100% 10.800 7.560 N TFE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172472.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487975 AATAATATCATATCAACGCCATTC pLX_317 13.7% 89.6% 95.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV