Transcript: Mouse NM_172473.3

Mus musculus HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 (Hace1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Hace1 (209462)
Length:
3785
CDS:
247..2976

Additional Resources:

NCBI RefSeq record:
NM_172473.3
NBCI Gene record:
Hace1 (209462)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172473.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086761 GCTGATATTAACAGGCCGAAT pLKO.1 808 CDS 100% 4.050 5.670 N Hace1 n/a
2 TRCN0000086758 CGCATGTAAAGTACCATTTAT pLKO.1 3366 3UTR 100% 15.000 12.000 N Hace1 n/a
3 TRCN0000311549 TTGAGGATTGTGAGGATATTT pLKO_005 1207 CDS 100% 15.000 10.500 N Hace1 n/a
4 TRCN0000311551 TTTCCCACGTTATACTTATAT pLKO_005 3446 3UTR 100% 15.000 10.500 N Hace1 n/a
5 TRCN0000306540 TGGTTATACAATGGCATAATG pLKO_005 2958 CDS 100% 13.200 9.240 N Hace1 n/a
6 TRCN0000003413 GCTGTGCCATATACTCCAAAT pLKO.1 2830 CDS 100% 10.800 7.560 N HACE1 n/a
7 TRCN0000086759 CCGGAAATTGATGTAAATGAT pLKO.1 2611 CDS 100% 5.625 3.938 N Hace1 n/a
8 TRCN0000332538 CCGGAAATTGATGTAAATGAT pLKO_005 2611 CDS 100% 5.625 3.938 N Hace1 n/a
9 TRCN0000086762 GCTATGGAAGAGGTGCCTTTA pLKO.1 2395 CDS 100% 10.800 6.480 N Hace1 n/a
10 TRCN0000332539 GCTATGGAAGAGGTGCCTTTA pLKO_005 2395 CDS 100% 10.800 6.480 N Hace1 n/a
11 TRCN0000086760 CCTTCCCTCATACAACTGTTT pLKO.1 2554 CDS 100% 4.950 2.970 N Hace1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172473.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.