Transcript: Mouse NM_172474.5

Mus musculus tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) (Tyw3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Mus musculus (mouse)
Gene:
Tyw3 (209584)
Length:
4404
CDS:
73..846

Additional Resources:

NCBI RefSeq record:
NM_172474.5
NBCI Gene record:
Tyw3 (209584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172474.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250615 ACTCACATTCCAAGATCAAAG pLKO_005 680 CDS 100% 10.800 15.120 N Tyw3 n/a
2 TRCN0000250618 ATCTCATCAAATCGAGTAAAT pLKO_005 1871 3UTR 100% 13.200 10.560 N Tyw3 n/a
3 TRCN0000250619 ACATGCTCTCAAACGAGAAAC pLKO_005 651 CDS 100% 10.800 7.560 N Tyw3 n/a
4 TRCN0000181992 CATGGATTGGAAGTCCCATTA pLKO.1 514 CDS 100% 10.800 7.560 N Tyw3 n/a
5 TRCN0000250617 GCACTCAGTGGCAATTGATTC pLKO_005 426 CDS 100% 10.800 7.560 N Tyw3 n/a
6 TRCN0000250616 TTGAGTTCCTGTTAACTATAG pLKO_005 572 CDS 100% 10.800 7.560 N Tyw3 n/a
7 TRCN0000177015 GAAACCATTTCAAACTCACAT pLKO.1 667 CDS 100% 4.950 3.465 N Tyw3 n/a
8 TRCN0000197896 GCAAGAGTTAATTTCTCTGTT pLKO.1 937 3UTR 100% 4.950 3.465 N Tyw3 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3805 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172474.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.